Archives

  • 2026-09
  • 2026-08
  • 2026-07
  • 2026-06
  • 2026-05
  • 2026-04
  • 2026-03
  • 2026-02
  • 2026-01
  • 2025-12
  • 2025-11
  • 2025-10
  • 2023-07
  • 2023-06
  • 2023-05
  • 2023-04
  • 2023-03
  • 2023-02
  • 2023-01
  • 2022-12
  • 2022-11
  • 2022-10
  • 2022-09
  • 2022-08
  • 2022-07
  • 2022-06
  • 2022-05
  • 2022-04
  • 2022-03
  • 2022-02
  • 2022-01
  • Influenza Hemagglutinin (HA) Peptide: Proven Tag for Reli...

    2025-12-23

    Influenza Hemagglutinin (HA) Peptide: Proven Tag for Reliable Protein Detection

    Executive Summary: The Influenza Hemagglutinin (HA) Peptide (sequence: YPYDVPDYA) is a synthetic nine-amino acid epitope tag routinely used in molecular biology for protein detection and purification (Wei et al., 2021). This peptide tag competitively binds to anti-HA antibodies, facilitating efficient elution in immunoprecipitation assays (APExBIO). It demonstrates high solubility in water (≥46.2 mg/mL), ethanol (≥100.4 mg/mL), and DMSO (≥55.1 mg/mL), supporting diverse buffer systems. The product, supplied by APExBIO, is confirmed to be >98% pure by HPLC and mass spectrometry. Integration of the HA tag supports advanced protein-protein interaction and exosome pathway research (EpitopePeptide, 2022).

    Biological Rationale

    The Influenza Hemagglutinin (HA) Peptide is derived from the hemagglutinin protein of the human influenza virus. This epitope sequence (YPYDVPDYA) was engineered as a molecular tag for recombinant proteins, enabling their detection and purification using specific anti-HA antibodies (Wei et al., 2021). The small size of the tag minimizes interference with protein folding or function. The HA tag’s sequence is highly conserved, reducing cross-reactivity and enhancing assay specificity (Magnetic-Co-IP, 2023). The use of epitope tags, such as the HA tag, has become standard for studying protein localization, quantification, and interactions in live cells and cell lysates.

    Mechanism of Action of Influenza Hemagglutinin (HA) Peptide

    The HA peptide functions as an epitope tag that binds specifically to anti-HA antibodies. When fused to a target protein, the tag allows for immunodetection or affinity purification. In immunoprecipitation assays, free HA peptide can be used to competitively displace HA-tagged proteins from immobilized anti-HA antibodies, enabling their gentle elution (APExBIO). This competitive binding is highly specific due to the unique sequence of the HA tag (EpitopePeptide, 2022). The peptide itself does not exhibit detectable biological activity in most mammalian systems, making it inert in downstream functional assays.

    Evidence & Benchmarks

    • HA tag fusion enables sensitive detection of recombinant proteins in Western blotting and immunofluorescence assays (Wei et al., 2021).
    • Competitive elution with synthetic HA peptide yields >90% recovery of HA-tagged proteins in immunoprecipitation workflows (APExBIO).
    • The HA peptide demonstrates solubility of ≥46.2 mg/mL in water and ≥100.4 mg/mL in ethanol, supporting high-concentration applications (APExBIO).
    • Purity is confirmed at >98% by HPLC and MS, ensuring reliable and reproducible results (APExBIO).
    • In exosome research, HA-tagged constructs have facilitated the tracking of protein sorting into multivesicular endosomes (MVEs) and exosome biogenesis (Wei et al., 2021).

    Applications, Limits & Misconceptions

    The Influenza Hemagglutinin (HA) Peptide is widely used as a protein purification tag, epitope tag for protein detection, and tool for protein-protein interaction studies. It is integral in workflows such as immunoprecipitation, Western blotting, immunofluorescence, and exosome pathway research (PamidronateDisodium, 2023). Compared to larger tags, the HA tag minimizes steric hindrance, allowing more accurate study of protein functionality. The sequence can be integrated at the N- or C-terminus of proteins with minimal disruption (AY-9944, 2023).

    This article extends the depth of application benchmarking beyond the overview in this foundational article by detailing quantitative solubility and purity metrics and providing up-to-date competitive binding data. For a comparison to traditional tags and exosome workflow integration, see this review, which this article updates with new purity standards and protocol recommendations.

    Common Pitfalls or Misconceptions

    • The HA tag peptide does not confer biological activity to fused proteins; it is inert in functional assays (APExBIO).
    • Excessive tag incorporation (multiple copies) can disrupt protein folding or function.
    • The peptide is not suitable for long-term solution storage; lyophilized storage at -20°C is recommended for stability.
    • Cross-reactivity may occur if anti-HA antibodies are not properly validated.
    • Not all anti-HA antibodies exhibit equal affinity; assay optimization may be required.

    Workflow Integration & Parameters

    For immunoprecipitation, the HA-tagged fusion protein is expressed in cells and captured with anti-HA antibody-conjugated beads. Elution is achieved by adding synthetic HA peptide at concentrations typically ranging from 0.5 to 2 mg/mL in phosphate-buffered saline (PBS, pH 7.4) at 4°C for 10–30 minutes (APExBIO). The high solubility of the A6004 peptide allows preparation of stocks in water, ethanol, or DMSO to match experimental requirements. For protein detection, standard anti-HA antibodies are used in Western blot or immunofluorescence protocols. The HA tag is compatible with most commercial expression vectors, and the DNA sequence (TACCCATACGATGTTCCAGATTACGCT) can be readily inserted using standard cloning techniques (Magnetic-Co-IP, 2023).

    For advanced exosome pathway research, HA-tagged constructs have aided in tracking protein sorting into multivesicular endosomes and exosomes, supporting studies on ESCRT-independent pathways (Wei et al., 2021). This article provides updated integration protocols compared to previous exosome applications, clarifying optimal peptide concentrations and elution conditions for next-generation workflows.

    Conclusion & Outlook

    The Influenza Hemagglutinin (HA) Peptide remains a gold standard for protein tagging due to its specificity, solubility, and inertness. Its adoption in immunoprecipitation, protein-protein interaction analysis, and exosome biogenesis research continues to expand as protocols are refined. The high-purity A6004 HA peptide from APExBIO provides researchers with reliable and reproducible results across multiple molecular biology platforms. Ongoing advances in exosome research and protein purification technologies are likely to further increase the utility of the HA tag in both basic and translational sciences.

    For detailed product specifications or to purchase the Influenza Hemagglutinin (HA) Peptide, visit the A6004 kit page at APExBIO.